Using fecal DNA metabarcoding to test if diet of migratory birds is correlated with Pb exposure level at a contaminated site in north Idaho: CO1 dataset
Resources
2 resources available
-
https://www.ncbi.nlm.nih.gov/bioproject/?term=PRJNA1277348
FILE -
Bird_CO1_SRA_metadata_Final.xlsx
XLSX
Find Related Datasets
Search by Tags
Click any tag below to search for similar datasets
Complete Metadata
| accessLevel | public |
|---|---|
| bureauCode |
[ "020:00" ] |
| contactPoint |
{ "fn": "Jay Reichman", "hasEmail": "mailto:reichman.jay@epa.gov" } |
| description | Fecal samples from migratory birds were collected from contaminated wetlands in the Bunker Hill Lower Basin Coeur ’d Alene River Watershed and from a Hepton Lake reference area St. Joe River Watershed during 2022-2024. Mitochondrial CO1 metabarcoding was used to confirm bird taxa from which samples were collected. CO1 primers with Illumina adaptors: CO1-F TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGAACATTCAGCCATCTTACCCGTG CO1-R GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGACAGGGAGTGATAGRAGKAGTAGG Also, chloroplast rbcL metabarcoding was used to identify plant taxa recently consumed by the birds, which can be found at DOI: 10.23719/1532393 |
| distribution |
[ { "title": "https://www.ncbi.nlm.nih.gov/bioproject/?term=PRJNA1277348", "accessURL": "https://www.ncbi.nlm.nih.gov/bioproject/?term=PRJNA1277348" }, { "title": "Bird_CO1_SRA_metadata_Final.xlsx", "mediaType": "application/vnd.openxmlformats-officedocument.spreadsheetml.sheet", "downloadURL": "https://pasteur.epa.gov/uploads/10.23719/1532394/Bird_CO1_SRA_metadata_Final.xlsx" } ] |
| identifier | https://doi.org/10.23719/1532394 |
| keyword |
[ "Amplicon-sequencing", "Birds", "CO1", "Pb toxicity" ] |
| license | https://pasteur.epa.gov/license/sciencehub-license.html |
| modified | 2025-06-26 |
| programCode |
[ "020:000" ] |
| publisher |
{ "name": "U.S. EPA Office of Research and Development (ORD)", "subOrganizationOf": { "name": "U.S. Environmental Protection Agency", "subOrganizationOf": { "name": "U.S. Government" } } } |
| references |
null
|
| rights |
null
|
| title | Using fecal DNA metabarcoding to test if diet of migratory birds is correlated with Pb exposure level at a contaminated site in north Idaho: CO1 dataset |