The files in this data release are the raw DNA sequence files referenced in the journal article by Goldsmith and others (2018) entitled "Comparison of microbiomes of cold-water corals Primnoa pacifica and Primnoa resedaeformis, with possible link between microbiome composition and host genotype". They represent a 16S ribosomal ribonucleic acid (rRNA) gene amplicon survey of the corals’ microbiomes (Primnoa spp.) completed using Roche 454 pyrosequencing with Titanium series reagents. The 16S rRNA gene was amplified using primers for the V4-V5 region (fwd: 5? AYTGGGYDTAAAGNG, rev: 5? CCGTCAATTYYTTTRAGTTT). The data also include two 23S rRNA gene Sanger sequences from Rhabdochlamydia bacteria from the microbiomes of Alaskan Primnoa corals. The 23S rRNA gene was amplified using forward primer 5? GATGCCTTGGCATTGATAGGCGATGAAGGA and reverse primer 5? TGGCTCATCATGCAAAAGGCA. Samples from Baltimore Canyon (in the Atlantic Ocean) were collected in 2012. Samples from Norfolk Canyon (in the Atlantic Ocean) were collected in 2012-2013. Samples from the Gulf of Alaska (Tracy Arm Fjord) were collected in 2011-2012. The raw data files associated with this study have also been submitted to the National Center for Biotechnology Information (NCBI) Sequence Read Archive (SRA) under Bioproject number PRJNA348705. The 23S sequences have been submitted to NCBI (GenBank) under accession numbers KY010287 and KY010288. Minimum information about a marker gene (MIMARKS) compliant metadata is provided in "Primnoa_metadata.txt", which is included in the data download file. For more information, please contact Christina Kellogg at the U.S. Geological Survey (USGS) St. Petersburg Coastal and Marine Science Center, 600 4th Street South, St. Petersburg, Florida, USA, 33701; Telephone: (727) 502-8128; Email: ckellogg@usgs.gov.